Public Library of Science
1. An Upstream Open Reading Frame Modulates Ebola Virus Polymerase Translation and Virus Replication
Reed S. Shabman, Thomas Hoenen, [...], and Christopher F. Basler
1.1. Abstract
Ebolaviruses,
highly lethal zoonotic pathogens, possess longer genomes than most
other non-segmented negative-strand RNA viruses due in part to long 5′
and 3′ untranslated regions (UTRs) present in the seven viral
transcriptional units. To date, specific functions have not been
assigned to these UTRs. With reporter assays, we demonstrated that the
Zaire ebolavirus (EBOV) 5′-UTRs lack internal ribosomal entry site
function.
However, the 5′-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5′-UTR derived from the viral polymerase (L) mRNA strongly suppressed translation of GFP compared to a β-actin 5′-UTR.
The L 5′-UTR is one of four viral genes to possess upstream AUGs (uAUGs), and ablation of each uAUG enhanced translation of the primary ORF (pORF), most dramatically in the case of the L 5′-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a “weak” Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress.
To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10–100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.
However, the 5′-UTRs do differentially regulate cap-dependent translation when placed upstream of a GFP reporter gene. Most dramatically, the 5′-UTR derived from the viral polymerase (L) mRNA strongly suppressed translation of GFP compared to a β-actin 5′-UTR.
The L 5′-UTR is one of four viral genes to possess upstream AUGs (uAUGs), and ablation of each uAUG enhanced translation of the primary ORF (pORF), most dramatically in the case of the L 5′-UTR. The L uAUG was sufficient to initiate translation, is surrounded by a “weak” Kozak sequence and suppressed pORF translation in a position-dependent manner. Under conditions where eIF2α was phosphorylated, the presence of the uORF maintained translation of the L pORF, indicating that the uORF modulates L translation in response to cellular stress.
To directly address the role of the L uAUG in virus replication, a recombinant EBOV was generated in which the L uAUG was mutated to UCG. Strikingly, mutating two nucleotides outside of previously-defined protein coding and cis-acting regulatory sequences attenuated virus growth to titers 10–100-fold lower than a wild-type virus in Vero and A549 cells. The mutant virus also exhibited decreased viral RNA synthesis as early as 6 hours post-infection and enhanced sensitivity to the stress inducer thapsigargin. Cumulatively, these data identify novel mechanisms by which EBOV regulates its polymerase expression, demonstrate their relevance to virus replication and identify a potential therapeutic target.
1.2. Author Summary
Filoviruses
(Ebola and Marburg viruses) are emerging zoonotic pathogens that cause
lethal hemorrhagic fever in humans and have the potential to be employed
as bioterrorism agents. Currently, approved therapeutics to treat
filovirus infections are not available and new treatment strategies
could be facilitated by improved mechanistic insight into the virus
replication cycle. Compared to other related viruses, filovirus
messenger RNAs have unusually long 5′ untranslated regions (UTRs) with
undefined functions. In the Zaire ebolavirus (EBOV) genome, four of its
seven messenger RNAs have 5′-UTRs with a small upstream open reading
frame (uORF). We found that a uORF present in the EBOV polymerase (L)
5′-UTR suppresses L protein production and established a reporter assay
to demonstrate that this uORF maintains L translation following the
induction of an innate immune response; a phenomenon observed with
several uORF-containing cellular messenger RNAs. The presence of the
uORF is important for optimal virus replication, because a mutant virus
lacking the upstream reading frame replicates less efficiently than a
wildtype virus, an attenuation which is more pronounced following the
induction of cellular stress. These studies define a novel mechanism by
which filovirus upstream open reading frames modulate virus protein
translation in the face of an innate immune response and highlight their
importance in filovirus replication.
2. Introduction
Ebolaviruses
(EBOVs) and marburgviruses (MARVs) comprise the filoviruses, a family
of enveloped, nonsegmented negative-sense (NNS) RNA viruses [1].
These zoonotic pathogens, which are associated with increasingly
frequent outbreaks in humans, cause lethal hemorrhagic fever and are of
concern as potential bioterrorism agents [2].
Currently, approved therapeutics to treat these infections are not
available. New treatment strategies could be facilitated by improved
insight into mechanisms regulating filovirus replication and gene
expression.
The genome of Zaire ebolavirus (EBOV), the
most deadly species of EBOV, is 18,959 nucleotides (nts) in length and
contains seven transcriptional units that direct synthesis of at least
nine distinct primary translation products:
In the case of EBOV, viral RNA synthesis requires the viral NP, VP35, VP30 and L proteins.
- the nucleoprotein (NP),
- virion protein (VP) 35,
- VP40,
- glycoprotein (GP),
- soluble glycoprotein (sGP),
- small soluble glycoprotein (ssGP),
- VP30,
- VP24 and
- the large (L) protein.L is the catalytic subunit of the polymerase complex.
In the case of EBOV, viral RNA synthesis requires the viral NP, VP35, VP30 and L proteins.
Transcription of filovirus mRNAs is presumed to occur as in other NNS
viruses, where there is a gradient of viral mRNAs with the abundance of
each mRNA transcript decreasing as the polymerase transcribes towards
the 5′ end of the template [3]–[6].
Each EBOV mRNA is presumed to be efficiently modified with a 5′-7-methylguanosine (m7G) cap and a 3′ p(A) tail [6]–[8].
Viruses
rely on the host cell for translation of their mRNAs.
A common innate antiviral mechanism is to globally inhibit protein synthesis through the phosphorylation of the alpha subunit of the factor eukaryotic initiation factor 2 (eIF-2α∼P) (reviewed in [9], [10]). In the absence of eIF-2α∼P, a complex consisting of eIF2, GTP, and a methionine-tRNA binds to a 40S ribosomal subunit to form the 43S preinitiation complex. The 43S subunit, in complex with additional initiation factors, binds to a 5′-m7G cap on an mRNA and scans the 5′-untranslated region (UTR) downstream to a start codon where translation initiation occurs [11].
When virus infection induces eIF2α∼P, eIF2-GTP levels decrease and translation initiation is impaired due to decreased recruitment of the initiator methionine tRNA [12]–[14]. eIF-2α∼P and subsequent inhibition of cap-dependent translation is regulated by several kinases including PKR, a protein that is induced by type I interferon (IFN-α/β) and activated by viral dsRNA [15], [16].
A common innate antiviral mechanism is to globally inhibit protein synthesis through the phosphorylation of the alpha subunit of the factor eukaryotic initiation factor 2 (eIF-2α∼P) (reviewed in [9], [10]). In the absence of eIF-2α∼P, a complex consisting of eIF2, GTP, and a methionine-tRNA binds to a 40S ribosomal subunit to form the 43S preinitiation complex. The 43S subunit, in complex with additional initiation factors, binds to a 5′-m7G cap on an mRNA and scans the 5′-untranslated region (UTR) downstream to a start codon where translation initiation occurs [11].
When virus infection induces eIF2α∼P, eIF2-GTP levels decrease and translation initiation is impaired due to decreased recruitment of the initiator methionine tRNA [12]–[14]. eIF-2α∼P and subsequent inhibition of cap-dependent translation is regulated by several kinases including PKR, a protein that is induced by type I interferon (IFN-α/β) and activated by viral dsRNA [15], [16].
Multiple
RNA viruses have devised strategies to circumvent host cell translation
control.
A common example would be viral 5′-UTRs that possess an internal ribosomal entry site (IRES) which allows translation of viral RNA without a 5′-m7G cap, thereby permitting translation of proteins in a cell where cap-dependent translation is impaired [9], [10], [17]. Notably, NNS RNA viruses have not been demonstrated to encode IRESes. Furthermore, the presence on each EBOV mRNA of a 5′-(m7G) cap and a 3′ p(A) tail [6]–[8], suggests that they are predominately translated by a cap-dependent mechanism.
Another strategy is employed by vesicular stomatitis virus (VSV), the prototype NNS RNA virus, which induces preferential translation of its own mRNAs over cellular mRNAs before eIF2α∼P occurs, triggering a global inhibition of host cell protein synthesis [18]–[21].
While similar to VSV in genetic organization, filoviruses modulate cellular translation in distinct ways. In addition to blocking IFN-α/β production and signaling pathways in infected cells [1], [22]–[30], EBOV also impairs PKR activation in HEK293 cells.
In contrast to VSV, global inhibition of host protein synthesis during infection has not been reported, although in vitro studies suggest that VP40 might downregulate host cell expression [19], [31]–[33]. However, in persistently infected mouse cells EBOV has been shown to induce PKR∼P and eIF2α∼P, and reducing eIF2α∼P in these cells reactivated virus replication [34]. Despite these observations, the mechanisms by which filoviruses may regulate viral mRNA translation in the absence and presence of eIF2α∼P is not completely understood.
A common example would be viral 5′-UTRs that possess an internal ribosomal entry site (IRES) which allows translation of viral RNA without a 5′-m7G cap, thereby permitting translation of proteins in a cell where cap-dependent translation is impaired [9], [10], [17]. Notably, NNS RNA viruses have not been demonstrated to encode IRESes. Furthermore, the presence on each EBOV mRNA of a 5′-(m7G) cap and a 3′ p(A) tail [6]–[8], suggests that they are predominately translated by a cap-dependent mechanism.
Another strategy is employed by vesicular stomatitis virus (VSV), the prototype NNS RNA virus, which induces preferential translation of its own mRNAs over cellular mRNAs before eIF2α∼P occurs, triggering a global inhibition of host cell protein synthesis [18]–[21].
While similar to VSV in genetic organization, filoviruses modulate cellular translation in distinct ways. In addition to blocking IFN-α/β production and signaling pathways in infected cells [1], [22]–[30], EBOV also impairs PKR activation in HEK293 cells.
In contrast to VSV, global inhibition of host protein synthesis during infection has not been reported, although in vitro studies suggest that VP40 might downregulate host cell expression [19], [31]–[33]. However, in persistently infected mouse cells EBOV has been shown to induce PKR∼P and eIF2α∼P, and reducing eIF2α∼P in these cells reactivated virus replication [34]. Despite these observations, the mechanisms by which filoviruses may regulate viral mRNA translation in the absence and presence of eIF2α∼P is not completely understood.
A characteristic of filovirus genomes is that they have long 5′- and 3′-UTRs relative to other NNS viruses [3], [5], [35], [36].
Our studies specifically focused on the 5′-UTRs of the seven EBOV
mRNAs, since 5′-UTRs are critical for translation initiation. Four of
the seven mRNAs contain small alternate upstream open reading frames
(uORFs), yet their significance remains uncharacterized. Interestingly,
uORFs are a common feature of cellular mRNAs and modulate translation of
a primary ORF (pORF) by decreasing the number and/or efficiency of
scanning ribosomes to reinitiate at the start codon of the pORF [37]–[42].
Multiple factors contribute to the frequency of translation initiation
at a uAUG versus a pAUG. These include the strength of the Kozak
consensus sequence surrounding the uAUG, where A/Gcc AUG
G is considered an optimal sequence.
Furthermore, the intercistronic space between the uORF and the pAUG, and the phosphorylation status of eIF-2α [38], [39], [43]–[45] determine whether translation occurs at a uAUG or pAUG. In the absence of eIF-2α∼P, cap-dependent translation is efficient allowing for higher rates of ribosome initiation at the uORF [11]. During conditions of enhanced eIF2α∼P, translation initiation is impaired causing a ribosome to scan past the uAUG and initiate at the pAUG. Consequently, under conditions of cell stress, eIF2α∼P promotes translation initiation at the pORF of select mRNAs possessing uORFs (e.g. ATF4, CHOP, GCN2 mRNAs) [12], [43], [46], [47].
Furthermore, the intercistronic space between the uORF and the pAUG, and the phosphorylation status of eIF-2α [38], [39], [43]–[45] determine whether translation occurs at a uAUG or pAUG. In the absence of eIF-2α∼P, cap-dependent translation is efficient allowing for higher rates of ribosome initiation at the uORF [11]. During conditions of enhanced eIF2α∼P, translation initiation is impaired causing a ribosome to scan past the uAUG and initiate at the pAUG. Consequently, under conditions of cell stress, eIF2α∼P promotes translation initiation at the pORF of select mRNAs possessing uORFs (e.g. ATF4, CHOP, GCN2 mRNAs) [12], [43], [46], [47].
In
this study, we characterized how the EBOV 5′-UTRs modulate translation.
Mutating any of the four uAUGs present in the EBOV genome enhances
translation at the corresponding pORF. The most dramatic effect was with
the L gene where the L uAUG can potently suppress pORF translation;
however, in response to eIF2α∼P, the L uAUG maintains L translation.
Modulating viral polymerase levels is biologically significant since
ablating the L uORF in a recombinant EBOV reduces viral titers
10–100-fold in cell culture, severely impairs viral RNA synthesis, and
functions to maintain virus titers in cells treated with stress inducing
agents. These data suggest that a uORF in the EBOV L mRNA regulates
polymerase expression in response to the status of the cellular innate
immune response and is required for optimal virus replication.
3. Results
3.1. Ebola virus 5′-UTRs do not exhibit IRES activity
To
our knowledge, there is no NNS RNA virus with demonstrated IRES
activity. However, EBOV 5′-UTRs are long, compared to those of most
other NNS RNA viruses, ranging between 80–460 nucleotides, and are
predicted to possess secondary structures [5] (and Figure S1).
Therefore, we tested if any of the EBOV 5′-UTRs are able to promote
cap-independent, internal translation initiation.

We designed a bicistronic reporter in the mammalian expression plasmid pCAGGS where the firefly luciferase ORF is followed by a multiple cloning site (MCS) and then by Renilla luciferase (Figure 1A). Each of the EBOV 5′-UTRs and the EMCV IRES were placed within the MCS, and these constructs were transfected into 293T cells. Eighteen hours post transfection, cells were harvested and subjected to a dual luciferase reporter assay. The EMCV IRES was able to drive cap-independent Renilla luciferase expression. However, none of the EBOV 5′-UTRs allowed detectable internal translation initiation as indicated by the Renilla luciferase reporter (Figure 1B). Furthermore, a NP 5′-UTR-GFP reporter mRNA lacking a m7G cap reduced GFP levels by over 90% as compared to a capped version of the same mRNA (data not shown). These data indicate that the EBOV 5′-UTRs do not function as IRESes and suggest that in infected cells they are translated by a cap-dependent mechanism, consistent with the capped-nature of EBOV mRNAs [6]–[8].
We designed a bicistronic reporter in the mammalian expression plasmid pCAGGS where the firefly luciferase ORF is followed by a multiple cloning site (MCS) and then by Renilla luciferase (Figure 1A). Each of the EBOV 5′-UTRs and the EMCV IRES were placed within the MCS, and these constructs were transfected into 293T cells. Eighteen hours post transfection, cells were harvested and subjected to a dual luciferase reporter assay. The EMCV IRES was able to drive cap-independent Renilla luciferase expression. However, none of the EBOV 5′-UTRs allowed detectable internal translation initiation as indicated by the Renilla luciferase reporter (Figure 1B). Furthermore, a NP 5′-UTR-GFP reporter mRNA lacking a m7G cap reduced GFP levels by over 90% as compared to a capped version of the same mRNA (data not shown). These data indicate that the EBOV 5′-UTRs do not function as IRESes and suggest that in infected cells they are translated by a cap-dependent mechanism, consistent with the capped-nature of EBOV mRNAs [6]–[8].
3.2. EBOV 5′-UTRs modulate translation of a downstream GFP reporter
To
test the role of EBOV 5′-UTRs in the context of cap-dependent
translation, we transfected equal amounts of in vitro transcribed mRNAs
in which individual EBOV 5′-UTRs were placed upstream of the GFP ORF (Figure 2A).

GFP was used to quantify the effects of each 5′-UTR on translation, because it was previously described to be a sensitive reporter with a large dynamic range suitable for translation assays [48]. As a control, we also transfected an mRNA construct with a β-actin 5′-UTR upstream of GFP (Figure 2A). The in vitro transcribed mRNAs were quantified by qRT-PCR. Equivalent copy numbers of each mRNA were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and the mean fluorescence intensity (M.F.I.) of the GFP positive population was quantified by flow cytometry and normalized to the M.F.I. of the β-actin 5′-UTR control (Figure 2B). Figure 2B summarize these data which are graphed from left to right according to the order of the genes as they appear in the viral genome. The NP, VP35, VP40 and VP30 5′-UTRs resulted in GFP expression comparable to the β-actin 5′-UTR construct. The GP and VP24 5′-UTRs modestly, but reproducibly, enhanced GFP expression relative to the β-actin control. qRT-PCR of RNA isolated from the transfected 293T cells in Figure 2C demonstrated comparable levels of GFP mRNA in each group at the time of the analysis, suggesting that any differences in GFP expression are due to differences in translation.
We also transfected primary human monocyte-derived dendritic cells (DCs), because DCs are important targets of EBOV infection in vivo [49] and analyzed GFP expression. In DCs, the GFP expression profile was similar to that observed in 293T cells (Figure 2D). In contrast to the other EBOV 5′-UTRs, the L 5′-UTR dramatically suppressed GFP expression in both 293T cells and DCs compared to the β -actin 5′-UTR (Figure 2B and D, the L bars are highlighted in gray). Representative histograms of flow cytometry data in each cell line are depicted in Figure 2E and 2F, displaying the effect of the L 5′-UTR mediated suppression of GFP compared to the β-actin control 5′-UTR.
GFP was used to quantify the effects of each 5′-UTR on translation, because it was previously described to be a sensitive reporter with a large dynamic range suitable for translation assays [48]. As a control, we also transfected an mRNA construct with a β-actin 5′-UTR upstream of GFP (Figure 2A). The in vitro transcribed mRNAs were quantified by qRT-PCR. Equivalent copy numbers of each mRNA were transfected into 293T cells. At 2.5 hours post transfection, cells were harvested and the mean fluorescence intensity (M.F.I.) of the GFP positive population was quantified by flow cytometry and normalized to the M.F.I. of the β-actin 5′-UTR control (Figure 2B). Figure 2B summarize these data which are graphed from left to right according to the order of the genes as they appear in the viral genome. The NP, VP35, VP40 and VP30 5′-UTRs resulted in GFP expression comparable to the β-actin 5′-UTR construct. The GP and VP24 5′-UTRs modestly, but reproducibly, enhanced GFP expression relative to the β-actin control. qRT-PCR of RNA isolated from the transfected 293T cells in Figure 2C demonstrated comparable levels of GFP mRNA in each group at the time of the analysis, suggesting that any differences in GFP expression are due to differences in translation.
We also transfected primary human monocyte-derived dendritic cells (DCs), because DCs are important targets of EBOV infection in vivo [49] and analyzed GFP expression. In DCs, the GFP expression profile was similar to that observed in 293T cells (Figure 2D). In contrast to the other EBOV 5′-UTRs, the L 5′-UTR dramatically suppressed GFP expression in both 293T cells and DCs compared to the β -actin 5′-UTR (Figure 2B and D, the L bars are highlighted in gray). Representative histograms of flow cytometry data in each cell line are depicted in Figure 2E and 2F, displaying the effect of the L 5′-UTR mediated suppression of GFP compared to the β-actin control 5′-UTR.
3.3. uAUGs present in the 5′-UTRs of the VP35, VP30, VP24 and L mRNA modulate translation initiation at the pAUG
One
feature of the 80 nt long L 5′-UTR that may influence translation of
the pORF is the presence of an uAUG and a corresponding uORF that
overlaps the pORF (Figure 2A).
However, the L 5′-UTR is only one of four EBOV 5′-UTRs that possess
uAUGs and uORFs. The VP35, VP30 and VP24 5′-UTRs also have small uORFs
upstream of the pORF. Unlike L, these do not overlap the pORF (Figure 2A).
In order to characterize the functional significance of these uAUGs, we
replaced the uAUG codons present in the VP35, VP30, VP24, and L 5′-UTRs
with UUG in the context of the GFP reporter (Figure 3A). RNA transfections were performed the same way as in Figure 2.
Flow cytometry demonstrated that each uAUG suppresses GFP signals,
since their ablation enhanced GFP expression in 293T cells (Figure 3B).
Quantitative RT-PCR analysis of RNA isolated from the transfected 293T
cells demonstrated comparable levels of GFP mRNA in each group at the
time of the analysis (Figure 3C).
We also performed the same experiment in DCs, which produced a GFP
expression profile similar to that obtained in 293T cells (Figure 3D).
In both 293T cells and DCs, ablation of the L 5′-UTR uAUG resulted in a 6.32 and 5.59 fold increase, respectively, in GFP signal relative to its corresponding 5′-UTR possessing a uAUG (Figure 3B and D, bars representing the L 5′-UTR data are highlighted in gray). By comparison, deleting the uAUG in the VP35, VP30, and VP24 5′-UTRs increased GFP expression between 1.75 and 3.20 fold in both 293T and DCs (Figure 3B and D). Representative histograms from 293T cells and DCs of the L 5′-UTR-GFP reporter with and without the uAUG are shown in Figure 3E and 3F. These data demonstrate that each of the uAUGs present in EBOV 5′-UTRs suppresses translation of the pORF, though the VP30 uAUG has the least dramatic effect on reporter expression. Because the uAUG of the L 5′-UTR had the most dramatic effect on pORF (GFP) translation, we chose to further characterize the L 5′-UTR.
In both 293T cells and DCs, ablation of the L 5′-UTR uAUG resulted in a 6.32 and 5.59 fold increase, respectively, in GFP signal relative to its corresponding 5′-UTR possessing a uAUG (Figure 3B and D, bars representing the L 5′-UTR data are highlighted in gray). By comparison, deleting the uAUG in the VP35, VP30, and VP24 5′-UTRs increased GFP expression between 1.75 and 3.20 fold in both 293T and DCs (Figure 3B and D). Representative histograms from 293T cells and DCs of the L 5′-UTR-GFP reporter with and without the uAUG are shown in Figure 3E and 3F. These data demonstrate that each of the uAUGs present in EBOV 5′-UTRs suppresses translation of the pORF, though the VP30 uAUG has the least dramatic effect on reporter expression. Because the uAUG of the L 5′-UTR had the most dramatic effect on pORF (GFP) translation, we chose to further characterize the L 5′-UTR.
3.4. The L 5′-UTR uAUG suppresses translation of an L protein-encoding mRNA
In
order to examine the impact of the L 5′-UTR in a more natural context,
the L 5′-UTR was placed, with or without the uAUG, upstream of sequence
corresponding to the first 505 amino acids (a.a.) of L followed by a
C-terminal FLAG-tag (Figure 4A).
This truncated version of L was used as a model transcript because of
the length of the L mRNA (6783 nt long, encoding a protein of 2212
a.a.). Each construct was cloned into an expression plasmid, and
equivalent amounts of each plasmid were transfected into 293T cells.
Consistent with the GFP reporter data, ablation of the uAUG in the L
5′-UTR substantially enhanced the signal of the L ORF by western blot (Figure 4B).
This effect was much more dramatic when L was co-transfected with the
polymerase co-factor VP35 and was specific for VP35 since
co-transfection with a plasmid expressing GFP did not enhance L
expression (compare lanes 1 and 2 with 3 and 4). The enhancing effect of
VP35 may reflect the ability of VP35 to promote L protein stability, as
the functional equivalent of VP35 in other NNS viruses stabilizes L
proteins [50]–[54], or it could reflect the ability of VP35 to stimulate translation through inhibition of PKR [32] (Figure 4B). These data confirm that the uAUG in the L 5′-UTR suppresses L expression in the context of its natural sequence.
3.5. Efficiency of translation initiation at the L uAUG is determined by its sequence context
We
sought to determine if the uAUG in the L 5′-UTR was accessible for
translation initiation by using our mRNA reporter assay. Therefore, we
placed GFP downstream of the entire L uORF sequence (Figure 5A).
GFP was clearly detectable in cells transfected with the uORF-GFP
reporter construct (compare the signal of mock transfected cells with
cells transfected with the uORF-GFP construct in Figure 5B). The amount of GFP signal was less than that of the β-actin 5′-UTR GFP control (Figure 5B),
a decrease in intensity that may be due to redistributed GFP into
punctate cytoplasmic foci, as a result of the uORF-GFP fusion (data not
shown). Furthermore, adding a “strong” Kozak sequence around the uAUG (A
at the −3 position and a G at the +4 position, where the A of the AUG
is designated as +1) increased GFP signal (Figure 5B).
Finally, a construct with only the first six nucleotides of the uORF
fused in frame with GFP translated GFP to the same level as the B-actin
GFP control. These data indicate that the L uAUG does initiate
translation.
3.6. A strong but not a weak uAUG Kozak sequence in the L 5′-UTR modulates pORF translation
We
further examined, in the context of the full length L 5′-UTR, the
effect of altering the Kozak sequence surrounding the uAUG (constructs
outlined in Figure 6A).
Introducing a strong Kozak sequence surrounding the uAUG suppressed GFP
translation (compare GFP levels between the wildtype L 5′-UTR reporter
and the uAUG SK construct in Figure 6B
and RNA levels in 6C). This is consistent with data in 5B, since an
increase in translation initiation at the uAUG would be expected to
suppress pAUG translation and therefore decrease GFP expression (Figure 6B).
In contrast, “weak” uAUG Kozak sequences did not enhance GFP signal
(compare uAUG WK1 and WK2 to the wildtype L 5′-UTR), suggesting that the
parental uAUG is in a weak translation initiation context. Introducing a
stop codon directly after the uAUG did enhance GFP (construct labeled
uAUG STOP); this likely reflects cap-dependent scanning and reinitiation
after the stop codon. Finally, ablating the uAUG codon to UUG or UCG,
changes expected to leave the L 5′-UTR predicted secondary structure
intact (Figure S1 and Table S1),
enhanced GFP expression 6–7 fold, providing further evidence that
translation initiation at the uAUG regulates expression of the pORF (Figure 6B).
3.7. Position-dependent suppression of pORF translation by the L uAUG
To
determine how the location of the L uAUG might affect pORF (GFP)
translation, the position of the uAUG was moved from its original
location (Figure 7A).
Strikingly, relocating the uAUG (while preserving the Kozak consensus
sequence at the −3 and +4 positions) only selectively repressed GFP
expression, since only one of the four reintroduced uAUGs suppressed
translation (Figures 7B and C). This indicates that the position of the L uAUG is important for its ability to regulate L translation.
3.8. Levels of L modulate EBOV RNA synthesis activity
The
L protein is the catalytic subunit of the EBOV RNA-dependent RNA
polymerase complex that carries out viral transcription and replication [55].
To address the functional significance of modulating L protein
expression, a transfection-based viral polymerase assay was used. The
components of the viral polymerase complex, i.e. EBOV proteins NP, VP35,
VP30 and L, were co-expressed with a minigenome consisting of a
reporter gene flanked by the cis-acting sequences required for viral
transcription and replication. Previous studies demonstrated that the
magnitude of the reporter signal fluctuates depending on the amount of
each viral co-factor titrated into this system [35], [56]–[58].
To expand on these studies, we titrated the L expression plasmid (which
lacks the native 5′-UTR of L). In the absence of L plasmid there was no
measurable reporter activity (Figure 8A).
Small amounts of L plasmid resulted in a rapid increase in activity,
but a two-fold increase in L plasmid from 400 to 800 ng dramatically
reduced polymerase activity (Figure 8A).
This suggests there is an optimal amount of L required for polymerase
activity and that excess L can be detrimental to viral RNA synthesis.
3.9. A recombinant EBOV lacking the L uAUG is attenuated in cell culture
To
determine the impact of the L uAUG on EBOV replication, a recombinant
EBOV was generated in which the uAUG was mutated to UCG. We confirmed
that the AUG→UCG mutation in the L 5′-UTR enhances translation at the
pORF in our established, 293T cell-based GFP reporter assay without
altering predicted RNA secondary structures (see Figure 6, Figure S1, and Table S1).
The genomes of both the recombinant wildtype and mutant EBOVs were
sequenced and confirmed to possess no additional mutations. Figure 8B outlines the predicted EBOV L mRNA for the wildtype and the L 5′-UTR mutant virus, while Figure 8C
displays the tissue culture infectious dose 50 (TCID50), the relative
copy number of vRNA, and the vRNA copy number to TCID50 ratio of both
the mutant and wildtype EBOVs. Figures 8D and 8E
display the growth kinetics of each virus in both Vero and A549 cells
after infection at a multiplicity of 0.005. The EBOV L 5′-UTR mutant
displayed slowed growth kinetics compared to the wildtype virus in both
Vero and A549 cells. This effect was more prominent in A549 cells where
the mutant virus grew to approximately a 100-fold lower titer by day 7
post infection (Figure 8E).
We further confirmed the growth defect of the L 5′-UTR mutant virus by
infecting both Vero and A549 cells at a higher MOI of 0.1 (Figure S2).
In both cell lines there were decreased mutant virus titers over the
first 4 days in culture, but the mutant virus did eventually reach
equivalent titers in both cell lines (Figure S2).
The AUG→UCG codon mutation was stable as a 700 nucleotide region
surrounding the L uAUG did not accumulate additional changes following
nine passages in A549 cells (data not shown). That second site repressor
mutations did not arise is in line with the in vitro data indicating
uAUG function is position dependent (Figure 7).
Therefore, sites where single nucleotide changes could introduce new
uAUGs might not create effective regulators of L translation. These data
demonstrate that the mutation of these two nucleotides, which lie
outside of any previously described regulatory or coding sequence,
significantly attenuates EBOV replication.
3.10. The EBOV L-5′UTR uAUG mutant virus is impaired for RNA synthesis at early time points post infection
We have not been able to generate antisera that detects the native L protein (data not shown and [59]).
Therefore, it has not been possible to directly assess the impact of
the uAUG mutation on L protein levels. To determine how mutation of the L
uAUG affects virus replication, RNA was isolated from A549 cells
infected with wildtype and mutant virus at a multiplicity of 1 at 6, 12,
and 24 hours post-infection and negative sense genomic RNA (vRNA) and
mRNA levels were assessed by quantitative RT-PCR (Figure 9A). The primer pairs in this study (Table S2) were validated with linearized plasmids encoding each of the seven EBOV genes (Figure S3).
As early as six hours post infection and at each additional time point,
the vRNA levels of the EBOV mutant virus were reduced compared to
wildtype EBOV (Figure 9B). This difference in RNA synthesis between the wildtype and mutant virus was also apparent for each of the seven viral mRNAs (Figures 9C–E).
Furthermore, differences in mRNA levels between the wildtype and mutant
virus were similar for each of the seven transcriptional units at all
times post infection and their abundance indicated the presence of a
transcriptional gradient, with NP mRNA being the most abundant and L
mRNA being the least abundant (Figure 9C–E). These data are consistent with the data obtained with the minigenome assay (Figure 8A), in which excess L levels result in decreased viral RNA synthesis.
3.11. The L uORF enhances L expression under conditions of cell stress
Multiple
stimuli including viral infection, UV irradiation, and treatment with
chemicals, such as thapsigargin (TG) can trigger cell responses that
induce eIF2α∼P and a general inhibition of host cell protein synthesis [12]–[14].
For a number of cellular transcripts possessing uORFs (e.g. CHOP,
ATF4), such stress conditions cause scanning ribosomes to bypass uAUGs,
resulting in enhanced translation at the pORF [43], [47].
To test if the L uORF might serve to maintain cap-dependent translation
initiation at the pAUG under circumstances where eIF2α∼P levels are
enhanced, we designed reporter constructs modeled after ones from
previous studies [43], [47].
An expression plasmid was generated with the L 5′-UTR followed by the
first 13 a.a. of L in frame with firefly luciferase (denoted L-FF, Figure 10A).
We also generated an identical construct without the uAUG (Lns-FF). To
test these reporter constructs in the absence or presence of cell
stress, we first determined that TG treatment did induce eIF2α∼P (Figure 10B). Next, 293T cells were transfected with a control Renilla
luciferase plasmid and either the L-FF or Lns-FF constructs.
Twenty-four hours post-transfection, 293T cells were treated with DMSO
(labeled D) or with four concentrations TG to induce eIF2α∼P, which was
measured at 6 hours post treatment by western blot (shown in Figure 10C). In the same experiment, cells were harvested at 10 hours post treatment, and the firefly/Renilla
luciferase ratio for each group was calculated. Consistent with the GFP
and western blot assays, the wildtype L 5′-UTR suppressed luciferase
signal relative to the L 5′-UTR without a uAUG (Figure 10D). Furthermore, cells transfected with L-FF and treated with TG exhibited a 2-fold increase in the firefly/Renilla ratio over a DMSO control (Figure 10D). The TG-mediated maintenance of L translation was dependent on the L uAUG, since the firefly/Renilla ratio of the Lns-FF construct, which lacks the uAUG, did not have the same effect under identical treatment conditions (Figure 10D).
3.12. The L uAUG modulates L translation and maintains EBOV replication following thapsigargin treatment in A549 cells
To confirm the 293T cell results, an additional stress assay was performed in A549 cells (Figure 11). This assay included the ATF4 5′-UTR upstream of firefly luciferase as a positive control to measure the stress response (Figure 11B and [43]). TG treatment specifically enhanced the Firefly/Renilla ratio 2–3 fold in the L-FF group compared to untreated cells (labeled U) or DMSO treated cells (labeled D, Figure 11B).
This effect was dependent on the uAUG, since the Firefly/Renilla ratio
in the Lns-FF transfected samples did not exhibit the same trend. We
also tested a construct where the uAUG was surrounded by the “strong”
Kozak sequence, demonstrated in Figures 5 and and66 to enhance translation at the uAUG (Lsk-FF, Figure 11A).
We predicted that a strong Kozak sequence would increase translation
initiation at the uAUG, decrease ribosome bypass, and suppress
translation at the pAUG. This sequence might also impair translational
modulation at the pAUG in response to cell stress, consistent with
studies examining the CHOP 5′-UTR [47].
Reporter gene expression from this Lsk-FF construct responded to TG
treatment similarly to L-FF, suggesting that this particular Kozak
sequence does not ablate the stress-responsive nature of the uAUG.
The L uAUG modulates L translation and maintains EBOV replication in response to eIF2α phosphorylation in A549 cells.
Finally,
we sought to address the impact of the L uAUG on EBOV replication under
stress conditions. A549 cells were infected with either the wildtype or
5′-UTR uAUG mutant EBOV and then treated with DMSO or with TG to induce
cell stress (illustrated in Figure 11C).
TG treatment decreased titers of both viruses compared to a DMSO
control. However, the wildtype EBOV titer was suppressed to a lesser
degree than was the mutant virus titer (labeled L 5′-UTR Mut, Figure 11D),
suggesting the uAUG functions to maintain virus replication in the
presence of a stress response. Taken together, both the reporter and
virus infection data indicate that the L uORF suppresses translation
initiation at the L pORF, but the uORF also allows levels of L
translation to be maintained when eIF2α∼P increases, as might occur due
to ER stress or activation of PKR during virus infection. This would
allow virus replication to be maintained in the presence of a host cell
innate immune response. A proposed model is illustrated in Figure 11E.
4. Discussion
EBOV
5′-UTR sequences are quite long relative to other NNS RNA viruses. The
average length of a EBOV 5′ UTR is 214 nt, compared to rabies virus
(RV), Newcastle disease virus (NDV) and VSV which are 23, 59 and 21 nt
respectively (Genbank: EF206716.1 and EF206716.1, and NC_001560.1).
Moreover, filovirus mRNAs are strikingly similar to eukaryotic mRNAs.
The average length of a eukaryotic mRNA 5′-UTR ranges from 90 to 210 nt
depending on the study [60]–[62]. Furthermore, while 30–40% of the eukaryotic transcriptome contains uORFs [63], [64],
none are present in VSV, RV or NDV. In contrast, four out of the seven
(57%) EBOV 5′-UTRs contain a uAUG/uORF. Our study provides evidence that
the 5′-UTRs of EBOV transcripts modulate translation and is consistent
with a scanning model of translation initiation [65].
The presence of uORFs within these 5′-UTRs suppresses translation of
pORFs, and most dramatically the translation of L. Furthermore, the L
uAUG enhances L translation in response to eIF2α∼P. NNS viruses regulate
their gene expression via a transcriptional gradient, where genes at
the 3′ end of the negative-sense genome are transcribed more abundantly
than those at the 5′ end ([3], [6] and illustrated in Figure 9).
This study provides evidence for an additional mechanism by which EBOVs
may regulate viral protein levels, demonstrates that an intact L uORF
is critical for optimal virus replication, and suggests that the L uORF
functions to maintain EBOV replication in the face of a cell stress
response.
There are several studies that implicate uORFs in regulating gene expression of both DNA and positive sense RNA viruses (e.g. [66]–[69]). More recently uORFs were shown to regulate cellular protein translation in response to cell stress [12], [43], [46], [47]. While there are other examples of NNS RNA viruses that encode a uORF [70], [71],
to our knowledge, our data provide the first description of a NNS RNA
virus that employs a uORF to regulate viral polymerase levels and to
regulate protein expression when eIF2α is phosphorylated. The data also
demonstrate that a uORF exerts a positive effect on filovirus
replication.
A previous study has characterized
regulatory regions of the EBOV genome by inserting these into a
minigenome reporter assay (each insertion included the 3′-UTR of the
upstream gene, the transcription stop and start signals, and the 5′-UTR
of the downstream gene) [72]. Results
from these experiments determined that regulatory regions encompassing
both the VP30 and L 5′-UTRs modestly suppress reporter activity. In
these assays, reporter activity was dependent upon virus transcription,
replication and translation of a reporter gene, in contrast to our
experiments which allow for the direct assessment of each EBOV 5′-UTR on
translation. Regardless of these differences, the data using the
regulatory region containing the L 5′-UTR is consistent with our assays
directly examining the effect of the L 5′-UTR on translation.
Functionally,
the EBOV UTRs can be divided into three classes.
First are 5′-UTRs lacking uORFs which translated reporter mRNAs to levels comparable to the β-actin 5′-UTR-GFP mRNA (NP, GP, VP40, Figure 2).
Second are those, other than L, that possess uORFs. These also translated reporter mRNAs to levels comparable to the β-actin control (VP35, VP30, and VP24). Ablating each of these uAUGs also enhanced GFP expression to levels above the β -actin 5′-UTR control mRNA (Figure 2 and and3).3).
Why we observe an enhancement in reporter signal after mutating each uAUG will be a focus of future studies.
The third group includes only the L 5′-UTR, which strongly suppresses translation of the pORF, a suppression mediated by the L uAUG (Figures 2–7)
. Interestingly, the first four nucleotides of the transcriptional start sequences are GAUG for each EBOV 5′ UTR (with the exception of NP and L). We did not test the function of these uAUGs since prior work demonstrates that an AUG this close to the 5′ end of an mRNA does not efficiently initiate translation [73].
First are 5′-UTRs lacking uORFs which translated reporter mRNAs to levels comparable to the β-actin 5′-UTR-GFP mRNA (NP, GP, VP40, Figure 2).
Second are those, other than L, that possess uORFs. These also translated reporter mRNAs to levels comparable to the β-actin control (VP35, VP30, and VP24). Ablating each of these uAUGs also enhanced GFP expression to levels above the β -actin 5′-UTR control mRNA (Figure 2 and and3).3).
Why we observe an enhancement in reporter signal after mutating each uAUG will be a focus of future studies.
The third group includes only the L 5′-UTR, which strongly suppresses translation of the pORF, a suppression mediated by the L uAUG (Figures 2–7)
. Interestingly, the first four nucleotides of the transcriptional start sequences are GAUG for each EBOV 5′ UTR (with the exception of NP and L). We did not test the function of these uAUGs since prior work demonstrates that an AUG this close to the 5′ end of an mRNA does not efficiently initiate translation [73].
Our
reporter assays indicate that the L uAUG initiates translation as
indicated by expression of constructs where the uORF was fused in frame
with GFP and is further supported by the observation that expression of
such constructs is enhanced by increasing the “strength” of the Kozak
sequence surrounding the uAUG (Figure 5).
That the uAUG plays a critical role in regulating L pORF translation is
supported by our studies demonstrating that altering the L uAUG from a
weak Kozak sequence to a strong Kozak sequence further attenuates pORF
(GFP) expression (Figure 6).
The location of the uAUG in the L 5′-UTR is also critical for
translation suppression, since only one of four constructs with
relocated uAUGs represses reporter translation (Figure 7).
It is interesting that the uAUG is predicted to lie at the top of a
stem-loop and is possible that this positioning contributes to uAUG
function (Figure S1).
Future studies will address this possibility. Finally, the L uAUG
maintains L translation in the presence of eIF2α∼P, when cap-dependent
translation is impaired (Figure 10 and and11).11). It will be interesting to determine if the other EBOV mRNAs with uORFs enhance translation in the presence of eIF2α∼P.
In
some respects, the L uORF resembles the arrangement of ATF4, CHOP, and
GCN2 mRNAs, which also encode overlapping and/or upstream uORFs [43], [46], [47].
The arrangement of the L 5′-UTR slightly differs from the ATF4 mRNA,
which has one additional upstream uORF and one overlapping uORF, but is
similar to CHOP mRNA, which has a single uORF 25nt upstream of the pORF [43], [47].
In our studies, addition of TG induced expression from the L 5′ UTR
construct by 2–3 fold, although in infected cells where L and VP35 are
co-expressed, the differences may well be greater (see Figure 4). Nonetheless, experiments with ATF4 and CHOP 5′-UTRs enhanced protein expression comparably ([43], [47] and Figure 11).
It is worth noting that ATF4 protein levels are very low in the absence
of cell stress. In contrast, some expression of the EBOV L protein must
be maintained to sustain virus replication. Therefore, it is likely
that the uORF arrangement of the EBOV L mRNA provides a mechanism to
keep translation of L low while allowing its upregulation in the
presence of eIF2α∼P. This would effectively maintain L expression under
cell stress conditions. Also, at four different doses of TG, we observed
a similar translational maintenance, consistent with previous ATF4 mRNA
studies [43]. Therefore, we propose that the L uORF modulates L translation by a similar mechanism (modeled in Figure 11E).
During conditions when eIF2-GTP is plentiful, translation initiates
more frequently at the L uAUG. Stress induced eIF2α∼P reduces eIF2-GTP
levels and the efficiency of translation initiation. Ribosomal subunits
therefore scan past the L uAUG to the pAUG at a higher frequency,
thereby maintaining L translation.
Experiments with the
5′-UTR of CHOP mRNA indicate that the Kozak sequence governs the
ability of a ribosome to bypass the uAUG during a stress response. The
CHOP uAUG is surrounded by a weak Kozak sequence, and a change to a
strong Kozak context diminishes the effect of the uAUG on pAUG
translation during a stress response. Like CHOP, the L uAUG is located
within a weak Kozak sequence. However, the L uAUG surrounded by a strong
Kozak sequence was still able to modulate translation at the pAUG
during a stress response (Figure 11). Therefore, the role of the Kozak sequence surrounding the EBOV L uAUG requires further investigation.
Maintaining
translation of L, the only viral protein with enzymatic activity, may
significantly impact virus transcription/replication in cells that have
begun to repress cap-dependent translation. To this point, our studies
clearly demonstrate the uAUG is critical to maintain virus titers in the
presence of cell stress, since a uAUG mutant virus was more sensitive
to TG treatment (Figure 11D).
It is possible that the uORFs in the VP35, VP30 and VP24 mRNAs serve a
similar purpose. Enhanced expression of VP35 and VP24 could benefit the
virus because these proteins counter innate immune responses, while VP35
and VP30, like L, are required for viral RNA synthesis ([23], [29] and reviewed in [74]).
Virus
infection triggers IFN-α/β production which induces expression of PKR, a
protein that is activated by viral dsRNA and phosphorylates eIF-2α to
inhibit cap-dependent translation [15], [16]. Relevant to our study are experiments that examined eIF2α∼P following VSV infection, the prototype NNS RNA virus [18]–[21].
VSV preferentially translates its own mRNAs over cellular mRNAs before
triggering eIF2α∼P and a global inhibition of host cell protein
synthesis [18]. Furthermore, it appears that VSV mRNAs contain cis-acting elements that enhance translation efficiency, though is it not clear what these elements are [20], [21].
Distinct from VSV infection, studies with EBOV indicate that it does not globally inhibit host cell protein synthesis [19]. Furthermore, EBOV infection suppressed PKR∼P in HEK293 cells [32]. In a different study, EBOV infection induced eIF2α∼P and PKR∼P in persistently infected mouse cells [34].
It was proposed that a persistent state might allow maintenance of
these zoonotic pathogens in their reservoir hosts (presumably select bat
species). Notably, inhibiting eIF2α and PKR∼P reactivated virus
replication [34].
These observations highlight the fact that eIF2α∼P can have a
significant outcome on EBOV replication in cell culture. However, the
specific mechanisms by which levels of eIF2α∼P modulate EBOV persistence
in vitro remain to be defined. The regulation of L translation by its
5′-UTR in response to eIF2α∼P suggests that EBOV encodes mechanisms to
respond to cell stress and provides one potential explanation for such
observations.
Regulating EBOV L levels may provide an
important balance during viral replication, as shown in the EBOV
minireplicon polymerase assays and in the recombinant EBOV mutant virus
lacking the uAUG in the L 5′-UTR. Our EBOV minireplicon data agrees with
previous work in 293T cells where increasing L while maintaining VP35,
VP30 and NP at specific rations could impair polymerase activity [58].
Another study demonstrated that low amounts of L were capable of
driving polymerase expression, though this activity did not diminish
with increasing amounts of L [35].
The latter system used a recombinant vaccinia virus expressing T7 RNA
polymerase in HeLa cells, while our T7 polymerase is expressed from a
plasmid in 293T cells. These experimental differences may account for
these apparently discrepant results. Regardless, all of this data
indicate that changes in L expression outside of a specific range may
significantly alter viral replication.
That L
expression levels must be tightly regulated is consistent with the data
obtained with the EBOV L uAUG mutant virus, which had reduced
replication in both Vero and A549 cells. While the L uAUG mutant virus
was able to reach similar titers to the wildtype virus by day 7 post
infection in Vero cells, the difference in growth was more pronounced in
A549 cells where the mutant virus never reached equivalent titers to
that of wildtype EBOV. One explanation for the enhanced growth defect in
A549 cells is provided by the data in Figure 9,
where there is a clear delay in virus transcription and replication
(indicated by differences in virus mRNA and vRNA levels). While we do
not have an antibody to detect full length L, our transfection studies
predict that without the uORF, L protein expression will be increased
under basal conditions and will not be properly regulated under
conditions of cell stress.
Translation initiation at
the uORFs in the L, VP30 and VP24 mRNAs would result in the translation
of small peptides in EBOV infected cells. The L uORF amino acid sequence
is conserved among Zaire EBOV strains, but the sequence is not
conserved between different filovirus species. However, L mRNAs from
multiple filoviruses do possess uORFs. For example, the Reston EBOV L
mRNA (AY769362.1) possesses an overlapping uORF of 24 a.a., and the Sudan EBOV has a uORF that terminates just 27nt upstream of the pORF (NC_006432.1). Sequence analysis from Marburg virus reveals the L mRNA of the Ravn strain possesses two uORFs in its 5′-UTR (EU500827.1) while the Angola strain has four uORFs (DQ447659).
It is likely these other uORFs are translated into small peptides in
infected cells, and it is possible that these peptides may perform a
specific function(s). In Drosophila, small peptides derived
from a polycistronic mRNA are required for proper development, since
ablating these ORFs disrupts actin-based cell morphogenesis [75].
Furthermore, nascent uORF peptides of fungi and yeast can interact with
the ribosome during their translation to inhibit translation at the
pORF [76], [77].
Given
that the mutation of the L uAUG significantly affects virus replication
in cell culture, it will be of interest to determine whether the
functions of the EBOV 5′-UTRs described in this report influence the
outcome of infection in vivo. If so, it is possible that these unique
functions may prove useful as targets for new therapeutic strategies.
The EBOV 5′-UTRs may represent potential targets of antiviral therapy,
since antisense RNA oligomers targeted against flavivirus and
coronavirus 5′-UTRs have successfully inhibited virus replication by
impairing translation [78], [79].
In addition, studies with antisense oligomers targeting the pAUGs of
EBOV VP35, VP24, and L block translation in vitro and provide protection
in animal models [80].
Our studies suggest that targeting additional regions of the mRNA, such
as the uAUGs/uORFs in addition to the pAUG may further improve the
efficacy of these treatments.
5. Materials and Methods
5.1. Biosafety and containment
Experiments
with live recombinant Ebola viruses were performed in BSL-4 containment
at the Rocky Mountain Laboratories (RML), Division of Intramural
Research (DIR), National Institute of Allergy and Infectious Diseases
(NIAID), National Institutes of Health (NIH), USA following Standard
Operating Procedures and approval by the Institutional Biosafety
Committee.
5.2. DNA constructs generated in this study
A bicistronic reporter construct was generated in the plasmid pCAGGS [81] and cloned between EcoRI and BglII sites, organized as follows: EcoRI-firefly luciferase-KpnI-Sac I-EcoRV-NheI-Renilla luciferase-BglII. Templates for the firefly and Renilla
luciferase were obtained from the plasmids pgl4.20 and pRLTK (Promega).
The EMCV IRES was obtained from the pCITE-4a(+)-GFP plasmid (Novagen).
Each of the EBOV 5′-UTRs (synthesized based on sequences from the strain
Mayinga (AY142960.1)) were introduced in the multiple cloning site (MCS) between the firefly and Renilla luciferase sequences. GFP reporter mRNAs cloned into pGEMT (Promega) downstream of either a EBOV 5′-UTR or a β-actin 5′-UTR [82]
were organized as follows: T7 promoter-5′UTR-SacI-GFP-FLAG. To
accommodate the overlapping L uORF with the GFP ORF, the L 5′-UTR was
cloned in the same manner as the other EBOV 5′-UTRs, between the T7
promoter and the SacI restriction site. The resulting construct
preserved the nucleotides coding for the first 11 amino acids of the L
uORF. Nucleotides coding for the C-terminal part of the uORF differed,
as they were derived from both the SacI and GFP sequence.
An
expression plasmid encoding L amino acids 1–505 was cloned into pCAGGS
as follows: SacI-L 5′UTR-L, amino acids 1 to 505-FLAG-XhoI. This
construct was also generated without the L uAUG (changed to UUG) in its
5′-UTR. An expression plasmid of L fused to firefly luciferase was
constructed as: SacI-L 5′UTR-L, amino acids 1 to 13-firefly
luciferase-XhoI.
5.3. Cells
293T,
VeroE6 and A549 cells were maintained in Dulbecco's minimal essential
medium with 10% fetal bovine serum and supplemented with L-glutamine and
penicillin/streptomycin. To generate monocyte-derived human dendritic
cells, buffy coats of anonymous healthy donors were obtained from the
New York Blood Center (Long Island, NY) under approved protocols. CD14+
monocytes were isolated from buffy coats (MiltenyiBiotec) and
differentiated for 7 days by culturing the cells in RPMI-1640 media
supplemented with penicillin, streptomycin, 55 mM β-mercaptoethanol, 4%
human serum AB (GemCell, Gemini Bio-Products, West Sacramento, CA), 500
U/ml human granulocyte-macrophage colony-stimulating factor (GM-CSF;
Peprotech, Rocky Hill, NJ) and 500 U/ml human interleukin-4 (IL-4;
Peprotech) [83].
5.4. In vitro transcription of mRNAs encoding reporter genes
Each
T7-5′UTR-GFP-FLAG reporter in pGEMT is flanked by NotI restriction
sites and was excised by a NotI digest. Equivalent nanograms of each DNA
template were used for T7 in vitro transcription (Ambion, Cat #AM1345).
Each transcription reaction was DNase I treated to remove input
template, polyadenylated, purified and resuspended in water according to
the manufacturer's instructions. Each RNA sample was quantified, and
equivalent nanogram amounts were reverse transcribed using random
hexamer primers (Qiagen, Cat# 205111). Each cDNA was then subjected to
real time quantitative PCR with primers specific for GFP (Bio-Rad C1000
Thermal Cycler). In addition, the quality of the RNA was analyzed by
agarose gel electrophoresis to ensure a single product of the correct
size. Both 293T cells and dendritic cells were transfected using
Lipofectamine 2000 (Invitrogen) with either equal copy numbers of mRNA
(determined by real time PCR) or equal nanograms of mRNA (both methods
produced similar results). Cells were analyzed for GFP expression by
flow cytometry and the mean fluorescence intensity of the GFP positive
cells was determined for each group. Also total RNA was isolated from
cells (Qiagen, Cat# 74104), and levels of GFP mRNA were determined by
real time RT-PCR from the same cells subject to FACS analysis. GFP
signal was normalized to either 18S ribosomal RNA or β-actin mRNA using
primers previously described [84].
5.5. Western blots to measure levels of FLAG-tagged proteins
To
measure the levels of pCAGGS L 1–505 with a C-terminal FLAG-tag, 293T
cells were transfected with pCAGGS-GFP-FLAG, pCAGGS-VP35-FLAG, or pCAGGS
L 1–505-FLAG by using Lipofectamine 2000 (Invitrogen). At 24 hours post
transfection, cells were harvested, washed in phosphate-buffered saline
(PBS) and lysed in NP-40 lysis buffer (50 mMTris [pH 7.5], 280 mM NaCl,
0.5% NP-40, 0.2 mM EDTA, 2 mM EGTA, 10% glycerol, and protease
inhibitors [Complete; Roche]). Lysates were incubated on ice for 30 min,
centrifuged for 10 min at 4°C in a microcentrifuge, and the
supernatants collected. Samples were subjected to polyacrylamide gel
electrophoresis and then transferred to a polyvinylidenedifluoride
membrane. The membrane was blocked in 5% nonfat dry milk, 0.1% Tween 20
in PBS, and then probed with a monoclonal mouse M2 α-Flag primary
antibody and a goat α-mouse secondary antibody (Sigma). Membranes were
developed using a Western Lightning ECL kit (Perkin-Elmer) and BioMax
film (Kodak).
5.6. Thapsigargin treatment and dual luciferase assays
pCAGGS
plasmids expressing the first 13 amino acids of L fused to firefly
luciferase both with and without the uAUG were transfected into 293T or
A549 cells. As a transfection and experimental control, pRLTK (Promega)
expressing Renilla luciferase was also transfected. At 24 hours
post transfection, cells were treated with thapsigargin (TG, Sigma,
Cat# T9033) and then harvested at the indicated hours post treatment for
a dual luciferase assay (Promega, Cat # E1960). The firefly/Renilla luciferase ratio was then determined for each group. Experiments were designed based on published studies [43], [47].
To measure the level of TG-induced eIF2-α phosphorylation, lysates
generated during the dual luciferase assay were subjected to western
blot analysis using a phosphospecific anti-eIF2α antibody (Invitrogen,
Cat# 44728G) and an antibody for total eIF2α (Cell Signaling, Cat#
9722).
5.7. EBOV transcription/replication assays
5.8. EBOV rescues and infections
A
cDNA copy of the full length genome of EBOV (strain Mayinga) flanked by
a T7 promoter and a hepatitis delta ribozyme and T7 terminator was
cloned into pAmp [86].
For cloning purposes and to serve as genetic markers 4 nucleotides
within the NP (c2149g, all positions correspond to the viral genome),
VP24 (a11043g) and L (c13194g, c15639g) ORFs were silently mutated, and
the resulting plasmid was designate pAmp-rgEBOV. Virus rescued from this
plasmid showed identical growth kinetics to a recombinant EBOV without
these mutations. To generate a cDNA clone for the mutant virus, a
subgenomic fragment of the genome was subcloned into pKan, the L uAUG
mutated (a11547t, t11548c), and cloned back into pAmp (pAmp-rgEBOV-Mut).
Both wildtype rgEBOV and mutant rgEBOV-Mut were rescued in VeroE6 cells
as previously described [86].
Briefly, 50% confluent VeroE6 cells were transfected using Transit LT1
(Mirus, cat #MIR 2300) according to the manufacturer's instructions with
the following plasmids: 125 ng pCAGGS-NP, 125 ng pCAGGS-VP35, 75 ng
pCAGGS-VP30, 1000 ng pCAGGS-L, 250 ng pCAGGS-T7, 250 ng full-length
plasmid. 24 hours post transfection the medium was exchanged, and after 7
days supernatant was transferred onto fresh VeroE6 cells. Upon
development of cytopathic effect (after 7–14 days) supernatant from
these cells was clarified and stocks frozen in liquid nitrogen. RNA from
these stocks was isolated and the entire genome was sequenced to ensure
there were no unwanted mutations. For virus growth curves, both Vero
and A549 cells were infected with each virus at a MOI of 0.005 and
supernatant was harvested each day for 7 days. Virus titers were
measured by tissue culture infectious dose 50 in VeroE6 cells. To
measure viral RNA levels, RNA from infected A549 cells (MOI of 1) was
isolated at 6, 12 and 24 hours post infection. To produce cDNA specific
for genomic (negative sense) RNA, total RNA was reverse transcribed in
independent reactions with six primers, each complementary to the
negative sense genomic RNA (Invitrogen, cat #18080-051). To produce cDNA
specific for messenger RNA, mRNA was first isolated from total RNA
(Invitrogen, cat# 610.06) and the mRNA fraction was reverse transcribed.
Real time PCR with validated primer pairs specific to the EBOV genome
were developed to quantify the relative amounts of each RNA species.
Sequences of the primer pairs are listed in Table S2 and standard curves generated with these primers off of DNA plasmids corresponding to each EBOV gene are displayed in Figure S3.
6. Supporting Information
Figure S1
RNA secondary structure in the L 5′-UTR is not significantly altered with the uAUG→uUUG or uUCG codon mutations.
Secondary structure analysis of uORF sequences shows minimum impact of
uAUG mutants. (A) Wildtype (B) mut1 (UCG) and (C) mut2 (UUG) sequences
show similar minimum free energy (MFE) secondary structures. Base
pairing probabilities for each of the sequences are shown on the right.
The top triangle of the box matrix dot plot represents the ensemble
structures, with the size of the box within the matrix corresponding to
the relative probability of forming a base pair within a given secondary
structure in the ensemble. The lower triangle represents the base
pairing of the MFE secondary structure. Sequence corresponding to AUG,
UCG and UUG, residues mutated within the uAUG sequence are highlighted
by light green, cyan, and pink color, respectively.
(EPS)
Click here for additional data file.(1.6M, eps)
Figure S2
Growth kinetics of WT EBOV and the L 5′-UTR uAUG mutant EBOV at a multiplicity of infection of 0.1.
A. Vero cells were infected in triplicate with both recombinant viruses at an MOI of 0.1. B.
A549 cells were infected with both recombinant viruses at an MOI of
0.1. Each day, supernatant was harvested and TCID50 titers were
determined on Vero cells. Each bar represents the means of triplicate
samples.
(EPS)
Click here for additional data file.(828K, eps)
Figure S3
Primer pairs for PCR amplification of each of the EBOV genes exhibit similar amplification efficiencies.
Primers specific for each of the seven EBOV transcriptional units were
designed and validated on linearized DNA plasmids encoding each of the
seven genes. Plasmids were normalized for absolute copy number and each
was diluted in serial 10-fold steps. An aliquot of each dilution was
used for quantitative PCR. The cycle threshold (CT) number is plotted on
the Y-axis while the plasmid copy number is plotted on the Y-axis.
Primer efficiencies of each of the seven primer pairs were determined to
be over 95%.
(EPS)
Click here for additional data file.(674K, eps)
Table S1
A summary of the results obtained for the computational secondary structure analysis.
Low ensemble diversity and good correspondence in the between the MFE
free energy and ensemble free energy for all three structures suggest a
high confidence for the proposed secondary structures. Of note, all
three structures have similar values and computational studies suggest a
low probability of impact on the secondary structure due to mutations
near the uAUG.
(DOCX)
Click here for additional data file.(14K, docx)
Table S2
Primer sequences used in this study.
(DOCX)
Click here for additional data file.(14K, docx)
| Primer name | Sequence (5' to 3') | |
| *NP2034f | CAGTGCGCCACTCACGGACA | |
| NP2106r | TGGTGTCAGCATGCGAGGGC | |
| *VP35 122f | GGCCATACTGCGGCCACGAC | |
| VP35 312r | TGACTGTTGCGCGTCTTCGGG | |
| *VP40 514f | TCCCGGATCATCCCCTCAGGC | |
| VP40 655r | GCAGCAGGCAGTGGTTGGGT | |
| *GP1928f | GGGGCGGCACATGCCACATT | |
| GP2056r | CCCCCTGGTCCGGAAGGGTT | |
| *VP30 579f | GCACCCAAGGACTCGCGCTT | |
| VP30 687r | TCGCCCAGTGTTCTGCCGTC | |
| *VP24 141f | TCGCCCCTGAGATACGCCACA | |
| VP24 338r | AGGGCGCTCAAAGTGATGTTCGT | |
| *L3031f | TGCGCCAGATTGTACGCAGGA | |
| L3201r | CGCTCGGCGTGCGTGAAAAG | |
| GFP542f | ACCACTACCAGCAGAACACC | |
| GFP744r | TTACTTATCGTCGTCATCCTTGT | |
| GFP476f | AGAACGGCATCAAGGTGAAC | |
| GFP612r | GGTGCTCAGGTAGTGGTTGTC | |
| * Primers used to generate cDNA to negative sense genomic RNA | ||
7. Acknowledgments
We
would like to thank Dr. Osvaldo Martinez and Benjamin Yen for preparing
human monocyte derived dendritic cells and Ariel Endlich-Frazier for
technical assistance. We would like to thank Dr. Ana Fernandez-Sesma for
access to her real time PCR machine. Dr. Ian Mohr (New York University)
provided helpful insight for experimental design.
8. Funding Statement
This work is supported by National Institutes of Health grants [AI059536, U54 AI 057158] (Northeast Biodefense Center-Lipkin) to CFB, [5F32AI084453] to RSS, and [AI081914] to GKA. This research was supported in part by the Intramural Research Program of the NIH, NIAID. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.9. Article information
PLoS Pathog. Jan 2013; 9(1): e1003147.
Published online Jan 31, 2013. doi: 10.1371/journal.ppat.1003147
PMCID: PMC3561295
Sean P. J. Whelan, Editor
Received April 25, 2012; Accepted December 6, 2012.
This
is an open-access article, free of all copyright, and may be freely
reproduced, distributed, transmitted, modified, built upon, or otherwise
used by anyone for any lawful purpose. The work is made available under
the Creative Commons CC0 public domain dedication.
This article has been cited by other articles in PMC.
Articles from PLoS Pathogens are provided here courtesy of Public Library of Science
10. References
1. Feldmann H, Geisbert TW (2011) Ebola haemorrhagic fever. The Lancet 377: 849–862 [PMC free article] [PubMed]
2. Bray M (2003) Defense against filoviruses used as biological weapons. Antiviral Research 57: 53–60 [PubMed]
3. Feldmann HME, Randolf A, Will C, Kiley MP, Sanchez A, et al. (1992) Marburg virus, a filovirus: messenger RNAs, gene order, and regulatory elements of the replication cycle. Virus Res 24: 1–19 [PubMed]
4. Iverson LE, Rose JK (1981) Localized attenuation and discontinuous synthesis during vesicular stomatitis virus transcription. Cell 23: 477–484 [PubMed]
5. Mühlberger E, Trommer S, Funke C, Volchkov V, Klenk H-D, et al. (1996) Termini of All mRNA Species of Marburg Virus: Sequence and Secondary Structure. Virology 223: 376–380 [PubMed]
6. Sanchez AKM (1987) Identification and analysis of Ebola virus messenger RNA. Virology 157: 414–420 [PubMed]
7. Ferron F, Longhi S, Henrissat B, Canard B (2002) Viral RNA-polymerases - a predicted 2′-O-ribose methyltransferase domain shared by all Mononegavirales. Trends in Biochemical Sciences 27: 222–224 [PubMed]
8. Weik M, Modrof J, Klenk H-D, Becker S, Muhlberger E (2002) Ebola Virus VP30-Mediated Transcription Is Regulated by RNA Secondary Structure Formation. J Virol 76: 8532–8539 [PMC free article] [PubMed]
9. Komarova
AV, Haenni A-L, Ramírez BC (2009) Chapter 3 Virus Versus Host Cell
Translation: Love and Hate Stories. In: Advances in Virus Research.
Murphy KMAJSFA, editor. Volume 73. Amsterdam: Academic Press/Elsevier.
pp. 99–170. [PubMed]
10. Walsh D, Mohr I (2011) Viral subversion of the host protein synthesis machinery. Nat Rev Micro 9: 860–875 [PubMed]
11. Hinnebusch
AG (2000) Mechanism and regulation of initiator methional-tRNA binding
to ribosomes. In: Translational Control of Gene Expression.; Sonnenberg
N, Hershey JWB, Mathews MB, editors. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
12. Wek RC, Jiang HY, Anthony TG (2006) Coping with stress: eIF2 kinases and translational control. Biochem Soc Trans 34: 7–11 [PubMed]
13. Mounir Z, Krishnamoorthy JL, Wang S, Papadopoulou B, Campbell S, et al. (2011) Akt Determines Cell Fate Through Inhibition of the PERK-eIF2{alpha} Phosphorylation Pathway. Sci Signal 4 (192)
ra62. [PMC free article] [PubMed]
14. Schmitt E, Naveau M, Mechulam Y (2010) Eukaryotic and archaeal translation initiation factor 2: A heterotrimeric tRNA carrier. FEBS Letters 584: 405–412 [PubMed]
15. Meurs EF, Watanabe Y, Kadereit S, Barber GN, Katze MG, et al. (1992) Constitutive
expression of human double-stranded RNA-activated p68 kinase in murine
cells mediates phosphorylation of eukaryotic initiation factor 2 and
partial resistance to encephalomyocarditis virus growth. J Virol 66: 5805–5814 [PMC free article] [PubMed]
16. Sen GC (2001) VIRUSES AND INTERFERONS. Annual Review of Microbiology 55: 255–281 [PubMed]
17. Stoneley MST, Le Quesne JP, Coldwell MJ, Jopling CL, Belsham GJ, et al. (2000) Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Research 28: 687–694 [PMC free article] [PubMed]
18. Connor JH, Lyles DS (2005) Inhibition of Host and Viral Translation during Vesicular Stomatitis Virus Infection. Journal of Biological Chemistry 280: 13512–13519 [PubMed]
19. Elliott LH, Kiley MP, McCormick JB (1985) Descriptive analysis of Ebola virus proteins. Virology 147: 169–176 [PubMed]
20. Whitlow ZW, Connor JH, Lyles DS (2006) Preferential Translation of Vesicular Stomatitis Virus mRNAs Is Conferred by Transcription from the Viral Genome. J Virol 80: 11733–11742 [PMC free article] [PubMed]
21. Whitlow ZW, Connor JH, Lyles DS (2008) New mRNAs Are Preferentially Translated during Vesicular Stomatitis Virus Infection. J Virol 82: 2286–2294 [PMC free article] [PubMed]
22. Basler CF, Mikulasova A, Martinez-Sobrido L, Paragas J, Muhlberger E, et al. (2003) The Ebola Virus VP35 Protein Inhibits Activation of Interferon Regulatory Factor 3. J Virol 77: 7945–7956 [PMC free article] [PubMed]
23. Basler CF, Wang X, Mühlberger E, Volchkov V, Paragas J, et al. (2000) The Ebola virus VP35 protein functions as a type I IFN antagonist. Proceedings of the National Academy of Sciences of the United States of America 97: 12289–12294 [PMC free article] [PubMed]
24. Cardenas WB, Loo Y-M, Gale M Jr, Hartman AL, Kimberlin CR, et al. (2006) Ebola Virus VP35 Protein Binds Double-Stranded RNA and Inhibits Alpha/Beta Interferon Production Induced by RIG-I Signaling. J Virol 80: 5168–5178